| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.053069 |
| Chromosome: | chromosome 11 |
| Location: | 2835932 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g477625 | CHLH2,MCH2 | Magnesium chelatase subunit H; (1 of 1) PTHR23304//PTHR23304:SF109 - SPOT2-RELATED // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAATCCCTACGGGGACTGTTCAAACCAACC |
| Internal bar code: | GATTAGCTCGGGTTGTTCGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 667 |
| LEAP-Seq percent confirming: | 99.2035 |
| LEAP-Seq n confirming: | 1121 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGATGTTTGGTGGACGTG |
| Suggested primer 2: | GGGGAGGGGTTACACTCATT |