Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.053077 |
Chromosome: | chromosome 10 |
Location: | 865470 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g423800 | KU80 | (1 of 1) K10885 - ATP-dependent DNA helicase 2 subunit 2 (XRCC5, KU80, G22P2); ATP-dependent DNA helicase 2 subunit KU80 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTTGGCGCGGGCCAGGCGGGAGCGGCTG |
Internal bar code: | GGCCAATTTGTTTCCCATCGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 381 |
LEAP-Seq percent confirming: | 94.0975 |
LEAP-Seq n confirming: | 3300 |
LEAP-Seq n nonconfirming: | 207 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGACCTGCAGTACTTCGCC |
Suggested primer 2: | GCTGGTGATAGTGGCAGTGA |