| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.053087 |
| Chromosome: | chromosome 7 |
| Location: | 5776107 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g353000 | (1 of 52) 2.7.11.22 - Cyclin-dependent kinase / Cdk-activating protein kinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCCGCCCGCCAGCGCCACTACAGCCAGG |
| Internal bar code: | GTTGGGCGTGCGCGAAGGTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 52 |
| LEAP-Seq percent confirming: | 18.8235 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 138 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGTGGCAGAGCAGACACT |
| Suggested primer 2: | GTGTGTGACAATGACCTCGG |