| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.053123 |
| Chromosome: | chromosome 12 |
| Location: | 3240816 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g498550 | MPM1,CHLM1,CHLM | Mg protoporphyrin IX S-adenosyl methionine O-methyl transferase; (1 of 1) K03428 - magnesium-protoporphyrin O-methyltransferase (E2.1.1.11, chlM, bchM) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGGGGCGCACGGCGCCTTGAGGTGTCGC |
| Internal bar code: | AAGGGACGACCGTTAGTACCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 563 |
| LEAP-Seq percent confirming: | 99.2531 |
| LEAP-Seq n confirming: | 11694 |
| LEAP-Seq n nonconfirming: | 88 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTTCACACAATCGTTTTGG |
| Suggested primer 2: | CAACTGCTAGCCCACATGAA |