| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.053286 |
| Chromosome: | chromosome 16 |
| Location: | 4164140 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g668950 | CPZ | (1 of 1) 3.4.17.1 - Carboxypeptidase A / Carboxypolypeptidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCTTGCCTGCCCCCTCTCCCCATGCCTG |
| Internal bar code: | GCGAGTGGCATAGCGACGGATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1176 |
| LEAP-Seq percent confirming: | 99.3996 |
| LEAP-Seq n confirming: | 1490 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGAGCTAATCACGTGCGAA |
| Suggested primer 2: | GTAACGGGTGTGTGGGAATC |