| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.053301 |
| Chromosome: | chromosome 9 |
| Location: | 3546423 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g389949 | (1 of 2) IPR000242//IPR000387//IPR003595//IPR029021 - PTP type protein phosphatase // Tyrosine specific protein phosphatases domain // Protein-tyrosine phosphatase, catalytic // Protein-tyrosine phosphatase-like | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTGGAGGAGACCGCGGCCCGAGAAGCGG |
| Internal bar code: | TGTTTAATTCGGCGAACCTCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 905 |
| LEAP-Seq percent confirming: | 96.3565 |
| LEAP-Seq n confirming: | 1957 |
| LEAP-Seq n nonconfirming: | 74 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACGCCTGTTGATGTTTCC |
| Suggested primer 2: | GTTGGGGGTTTGAATCAATG |