Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.053345 |
Chromosome: | chromosome 10 |
Location: | 6496444 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g466450 | (1 of 89) PF00076 - RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (RRM_1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGCCGGACCCCATGCCCCAAAGCCCCCC |
Internal bar code: | GGCCGTCCGCCAGTTTTCTTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 860 |
LEAP-Seq percent confirming: | 99.4092 |
LEAP-Seq n confirming: | 2692 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCAATGTGTGAGGACGTGG |
Suggested primer 2: | ACCGTAGCTGTTGGTGTTCC |