Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.053395 |
Chromosome: | chromosome 6 |
Location: | 7414532 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g299700 | SOUL1 | (1 of 4) IPR006917//IPR011256 - SOUL haem-binding protein // Regulatory factor, effector binding domain; SOUL heme-binding protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATTAGCATTCAGCCGCCGGCCGGCATGGA |
Internal bar code: | GACTGTGTCAAAAGACGATTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 973 |
LEAP-Seq percent confirming: | 99.4635 |
LEAP-Seq n confirming: | 4820 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATAGCCAGCTACACAGCCA |
Suggested primer 2: | AAGAAGGTGAGAGCCAAGCA |