| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.053450 |
| Chromosome: | chromosome 14 |
| Location: | 2519797 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g625300 | CAX3 | (1 of 1) PTHR12266//PTHR12266:SF9 - NA+/CA2+ K+ INDEPENDENT EXCHANGER // CATION/CALCIUM EXCHANGER 3-RELATED; CAX family cation antiporter, membrane protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCATGACCTTCGCGAATCCCCACGCCTT |
| Internal bar code: | ATGGGTGGGACTCGCAACCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 666 |
| LEAP-Seq percent confirming: | 99.6904 |
| LEAP-Seq n confirming: | 2576 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCTACACCTCCCCCAATCC |
| Suggested primer 2: | AAGAAGTGAAGGCGTAGCCA |