| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.053461 |
| Chromosome: | chromosome 12 |
| Location: | 8517855 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g547750 | SCS1,SPCS,SPCS1 | (1 of 1) 2.9.1.2 - O-phospho-L-seryl-tRNA(Sec):L-selenocysteinyl-tRNA synthase / SepSecS; Selenocysteine synthase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTTTTGGCAGTGGGTGTGGGGCGGGTGT |
| Internal bar code: | TGATGCCAGTGCGGGCGCTCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 631 |
| LEAP-Seq percent confirming: | 84.5677 |
| LEAP-Seq n confirming: | 2592 |
| LEAP-Seq n nonconfirming: | 473 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTACTTGCCTTCAGCGTCC |
| Suggested primer 2: | GACACTTGGACTCGTGCTCA |