| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.053497 |
| Chromosome: | chromosome 14 |
| Location: | 1386334 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g617300 | PSL3 | (1 of 1) PTHR12174//PTHR12174:SF42 - SIGNAL PEPTIDE PEPTIDASE // SUBFAMILY NOT NAMED; Signal peptide peptidase-like protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGCCGCCTGCAAACCCTGTCCTCCACAC |
| Internal bar code: | TTGGTCCAGGTCAATATGTCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 616 |
| LEAP-Seq percent confirming: | 99.2399 |
| LEAP-Seq n confirming: | 16060 |
| LEAP-Seq n nonconfirming: | 123 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCGTAGCCAACGACATCA |
| Suggested primer 2: | TAACTTGGCACCCAGAAACC |