Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.053583 |
Chromosome: | chromosome 1 |
Location: | 5644274 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g040200 | WNK2 | (1 of 5) K08867 - WNK lysine deficient protein kinase [EC:2.7.11.1] (WNK, PRKWNK); WNK protein kinase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAACTCCAGTCCAAGGTCATATTCACAACG |
Internal bar code: | GCTCCGGTTCGGTAACACTCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1000 |
LEAP-Seq percent confirming: | 97.3966 |
LEAP-Seq n confirming: | 636 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCGTGGGTAGGGCAATAAG |
Suggested primer 2: | TCGACGAGTCGTGCAGTATC |