| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.053608 |
| Chromosome: | chromosome 6 |
| Location: | 6964525 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g296350 | SENP5,ULP1 | ULP2-type SUMO protease; (1 of 5) 3.4.22.68 - Ulp1 peptidase / Ulp1 protease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCAGACATCGGGCTGGCTCCAGAGGCGT |
| Internal bar code: | TGACGCTGCATGGGTAGCGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 150 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 206 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGCTGTTCCCCATCAATC |
| Suggested primer 2: | AGGTAGGAGAAGCAGAGGGC |