Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.053735 |
Chromosome: | chromosome 1 |
Location: | 6363150 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g045350 | DRC5,FAP155 | (1 of 1) PTHR24107//PTHR24107:SF2 - FAMILY NOT NAMED // T-COMPLEX-ASSOCIATED TESTIS-EXPRESSED PROTEIN 1; Nexin-dynein regulatory complex 5 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTAATGGACGTGCGCATGACGGGCATCAA |
Internal bar code: | TCGCAGCGTTACGTTCACAGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 822 |
LEAP-Seq percent confirming: | 99.1495 |
LEAP-Seq n confirming: | 18770 |
LEAP-Seq n nonconfirming: | 161 |
LEAP-Seq n unique pos: | 74 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGTACTGATGAATGCATGG |
Suggested primer 2: | TGAGGATTGAGCTGTGATGC |