Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.053784 |
Chromosome: | chromosome 12 |
Location: | 4613043 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g522750 | GT90F22,GT90-22 | GT90 family protein 22; (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACAGAAGCCCGCCCAACCCTTCCTCGGG |
Internal bar code: | AGGCATTGGGGCAATGACTTTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 517 |
LEAP-Seq percent confirming: | 94.8718 |
LEAP-Seq n confirming: | 1813 |
LEAP-Seq n nonconfirming: | 98 |
LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTGCTCACTTACAGGAGGC |
Suggested primer 2: | GGTAGCTACATCCCAGCCAA |