| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.053922 |
| Chromosome: | chromosome 3 |
| Location: | 2688498 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g161250 | CYP748A1,CYP14 | (1 of 2) PTHR24305:SF65 - CYTOCHROME P450 12A4, MITOCHONDRIAL-RELATED; Cytochrome P450, CYP197 superfamily | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGAGAAGGGAGGGGCAGGCATGGCCGCAC |
| Internal bar code: | CTCTGCGGCTTGGACCGGAAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 264 |
| LEAP-Seq percent confirming: | 81.2789 |
| LEAP-Seq n confirming: | 1055 |
| LEAP-Seq n nonconfirming: | 243 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGCACACACTGCAAGTCC |
| Suggested primer 2: | GTGTGTCGGATACAGCATGG |