Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.053983 |
Chromosome: | chromosome 8 |
Location: | 4834749 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g384500 | (1 of 1) PF08856 - Protein of unknown function (DUF1826) (DUF1826) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGCACCAGGCGCCCACCACGCCCACCCA |
Internal bar code: | GGCGAGCAAACAGGCTAATCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 622 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 18 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTACGTCGTGAAAGGCTG |
Suggested primer 2: | GCGAGTTTGGTGGTGTAGGT |