Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.053989 |
Chromosome: | chromosome 3 |
Location: | 5078722 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g181200 | (1 of 1) K01969 - 3-methylcrotonyl-CoA carboxylase beta subunit (E6.4.1.4B) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCATCGGTTTAGGATGCGGCATGAGCTGC |
Internal bar code: | GCTCACATTTTGTGCGTGCACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 947 |
LEAP-Seq percent confirming: | 98.452 |
LEAP-Seq n confirming: | 954 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCGAAAGTTTCCATGTTCC |
Suggested primer 2: | GAGTCGCTCAAGGTGCTAGG |