| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.054022 |
| Chromosome: | chromosome 6 |
| Location: | 4214181 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278236 | UMM12 | (1 of 1) PTHR10108:SF871 - METHYLTRANSFERASE; Putative ubiquinone / menaquinone biosynthesis methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCATTGCGCTCGCGTGCCTGCACGCAATC |
| Internal bar code: | GGGCCTCCCTAGCGACTCTACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 917 |
| LEAP-Seq percent confirming: | 98.5136 |
| LEAP-Seq n confirming: | 1922 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAGCTTGTTGATGACCTGA |
| Suggested primer 2: | TACGTGGTGATGGCTACCAA |