| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.054130 |
| Chromosome: | chromosome 6 |
| Location: | 6925059 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g296050 | FMO6 | (1 of 2) PF13738 - Pyridine nucleotide-disulphide oxidoreductase (Pyr_redox_3); Flavin-containing monooxygenase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGTGAAGCGCAGGGAGGCGATTGCTGCTG |
| Internal bar code: | ATTATTGTGTGCTAATTAGATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 392 |
| LEAP-Seq percent confirming: | 99.6301 |
| LEAP-Seq n confirming: | 808 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTACAGGCATCAGAGCCA |
| Suggested primer 2: | TGCATAGGCAAGCACTCATC |