| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.054138 |
| Chromosome: | chromosome 3 |
| Location: | 3407246 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g166900 | CYP767A1,CYP15 | (1 of 1) 1.14.13.98 - Cholesterol 24-hydroxylase / Cytochrome P450 46A1; Cytochrome P450, CYP4 superfamily | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGTCGTGGTGTTGCAGCAGGTCAGGGGC |
| Internal bar code: | CGTCCCGATGCCGTGTAAGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 138 |
| LEAP-Seq percent confirming: | 98.75 |
| LEAP-Seq n confirming: | 316 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAGTGAGGGTTTGGAGGGT |
| Suggested primer 2: | GTTGGCTGAGGATTGTTGGT |