| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.054197 |
| Chromosome: | chromosome 13 |
| Location: | 3780291 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g589700 | VPS20 | Subunit of ESCRT-III complex; (1 of 1) K12195 - charged multivesicular body protein 6 (CHMP6, VPS20) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCCCCAAACCTCCCGCCCCTGTAAGTGC |
| Internal bar code: | GCACTTGCTCAGGCGGAGTGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 757 |
| LEAP-Seq percent confirming: | 73.854 |
| LEAP-Seq n confirming: | 2014 |
| LEAP-Seq n nonconfirming: | 713 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAAGGCTGGAGTCGTGGAGT |
| Suggested primer 2: | CTGTTGCGATTGTTGCTGTT |