| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.054200 |
| Chromosome: | chromosome 6 |
| Location: | 4349251 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278264 | (1 of 2) PF07082 - Protein of unknown function (DUF1350) (DUF1350) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCGAGGCGCTGTGGCGGGGGCGGGGGAC |
| Internal bar code: | CATGTTAGCCGGCTCCCCGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 898 |
| LEAP-Seq percent confirming: | 99.6429 |
| LEAP-Seq n confirming: | 558 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAGAGCGCTTGCTTGAGAG |
| Suggested primer 2: | TCCATCCTGGAGTTCCAAAG |