| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.054240 |
| Chromosome: | chromosome 3 |
| Location: | 7884747 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g202500 | (1 of 1) PF04836//PF05004 - Interferon-related protein conserved region (IFRD_C) // Interferon-related developmental regulator (IFRD) (IFRD) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTTTGGCTTCCAGCCGCGCGCGGAGCGG |
| Internal bar code: | GAAGAGGGTCCGTAGGAGGCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 417 |
| LEAP-Seq percent confirming: | 98.806 |
| LEAP-Seq n confirming: | 331 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTGAAGGTTGCAAGAGGC |
| Suggested primer 2: | TTAACACTTAGGTTGGGCGG |