Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.054249 |
Chromosome: | chromosome 10 |
Location: | 2301796 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g434600 | TRP21,FAP148 | (1 of 1) PTHR22847//PTHR22847:SF493 - WD40 REPEAT PROTEIN // SUBFAMILY NOT NAMED; Cation Channel Domain Flagellar Associated Protein 148 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTAATTTGTGGTACTGTCAACGAGACAC |
Internal bar code: | AGAGGCTTACGGCTTGTGGTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 681 |
LEAP-Seq percent confirming: | 99.0615 |
LEAP-Seq n confirming: | 950 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGATGCTCATGTGAGTTGCG |
Suggested primer 2: | TTAACCCGATTCCAAACTGC |