Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.054253 |
Chromosome: | chromosome 7 |
Location: | 4154662 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g342552 | UBC37 | E2 ubiquitin conjugating enzyme; (1 of 93) 6.3.2.19 - Transferred entry: 2.3.2.23, 2.3.2.27 and 6.2.1.45 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATCCACAAGATCTTCACACACGCCGACT |
Internal bar code: | TACAAGTCCGTGACGCCACGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 0 |
LEAP-Seq percent confirming: | 0.0 |
LEAP-Seq n confirming: | 0 |
LEAP-Seq n nonconfirming: | 397 |
LEAP-Seq n unique pos: | 0 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACCAGGCTGTTCATGAGG |
Suggested primer 2: | GCGGCAGTAGCAAGGAATAG |