| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.054288 |
| Chromosome: | chromosome 3 |
| Location: | 1827482 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g154425 | CLASP,CLASP1 | (1 of 1) K16578 - CLIP-associating protein 1/2 (CLASP1_2); CLIP-associating-protein | intron|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTACCGCAGGGGTGTTGCACGCAGCGAATA |
| Internal bar code: | TCGAAGCACCGGGTTCCGTGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 111 |
| LEAP-Seq percent confirming: | 3.89541 |
| LEAP-Seq n confirming: | 146 |
| LEAP-Seq n nonconfirming: | 3602 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTTGATCGCCTCGTAGAAG |
| Suggested primer 2: | AACAAGTCGGAGCTTGGAGA |