| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.054387 |
| Chromosome: | chromosome 5 |
| Location: | 1400973 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g244250 | DHC6 | Axonemal Dynein Heavy Chain 6; (1 of 3) PTHR10676//PTHR10676:SF242 - DYNEIN HEAVY CHAIN FAMILY PROTEIN // DYNEIN HEAVY CHAIN 3, AXONEMAL | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAACATGATCTTCGAAGTCCAGGACCTGG |
| Internal bar code: | GGCGCAGGACGGTCCGTGTTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 932 |
| LEAP-Seq percent confirming: | 99.0979 |
| LEAP-Seq n confirming: | 769 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAGCTCGTCCATGAGTGAC |
| Suggested primer 2: | GGTGCTCATGCGCATACTTA |