Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.054424 |
Chromosome: | chromosome 1 |
Location: | 2207721 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g012050 | NAR1F | Formate/nitrite transporter; (1 of 7) PTHR30520 - FORMATE TRANSPORTER-RELATED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTGTCCACCGGCGTGTCAACCGCCGGCT |
Internal bar code: | GTCGAATCGAGTGTTGTCCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 726 |
LEAP-Seq percent confirming: | 99.556 |
LEAP-Seq n confirming: | 1794 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCTGGTGTGGAGATAAGGA |
Suggested primer 2: | CACACGGTACGATGATTGGA |