| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.054526 |
| Chromosome: | chromosome 9 |
| Location: | 7493421 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g413900 | GT90F18,GT90-18 | (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90); GT90 family protein 18 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCTCATCCTCATTAGCGCTATGCCTCCT |
| Internal bar code: | CCCGGGTTTGATTTACCGTCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 420 |
| LEAP-Seq percent confirming: | 98.8739 |
| LEAP-Seq n confirming: | 4390 |
| LEAP-Seq n nonconfirming: | 50 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCCGGAAAGGAAAGTACC |
| Suggested primer 2: | CGCCGATTTGTTCAATACCT |