| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.054886 |
| Chromosome: | chromosome 12 |
| Location: | 1202080 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g489650 | (1 of 6) IPR002557 - Chitin binding domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAAGGTGTGACGATGTGTACATGGGTAGG |
| Internal bar code: | TGGCAAAGCCTACTGTTATATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 364 |
| LEAP-Seq percent confirming: | 82.3072 |
| LEAP-Seq n confirming: | 4238 |
| LEAP-Seq n nonconfirming: | 911 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACTCCGGCAACGGTAGTAT |
| Suggested primer 2: | AGTATGTTGCCGACCACTCC |