| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.054912 |
| Chromosome: | chromosome 10 |
| Location: | 332935 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g420350 | PSAE,PSAE1 | (1 of 1) K02693 - photosystem I subunit IV (psaE); Photosystem I reaction center subunit IV, 8.1 kDa | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGATCGCATGGGCTCGCCGGGGTCGGGGG |
| Internal bar code: | GTGGGAGGCCTCGACAATTTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1392 |
| LEAP-Seq percent confirming: | 99.1183 |
| LEAP-Seq n confirming: | 5846 |
| LEAP-Seq n nonconfirming: | 52 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTTACTTGGCGGCAACAAC |
| Suggested primer 2: | GTGGGAATGTCAGCTACCGT |