Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.054924 |
Chromosome: | chromosome 7 |
Location: | 3678841 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g337450 | GT90F9,GT90-9,CGL75 | Glycosyl transferase GT90 family protein 9; (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGGTCCACAGCACCGCGCAGGTTGCATA |
Internal bar code: | GGTCCGTTCTTCGCCTGGGAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 601 |
LEAP-Seq percent confirming: | 98.6842 |
LEAP-Seq n confirming: | 75 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACTGGCAGGTACTGGGGTC |
Suggested primer 2: | TGCTTTTTGCTCCCAAGACT |