Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.054936 |
Chromosome: | chromosome 9 |
Location: | 1689429 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g397000 | (1 of 28) PTHR31600//PTHR31600:SF2 - FAMILY NOT NAMED // TINY MACROCYSTS PROTEIN B-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAAGGAGGCCAACTGTCAAGGTACCGCG |
Internal bar code: | GCCCGTACACACGGGCTAAGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 699 |
LEAP-Seq percent confirming: | 99.692 |
LEAP-Seq n confirming: | 2266 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCGCCTGTAGTATCGCCTC |
Suggested primer 2: | TTTGAGGGCCCATAACTTTG |