| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.055026 |
| Chromosome: | chromosome 16 |
| Location: | 5950022 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g676900 | UAA5 | UDP-galactose transporter; (1 of 2) K15276 - solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2 (SLC35B2, PAPST1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTCGAAACACTGTCCGAGATACGGTGGT |
| Internal bar code: | CGGTCTTCAACCGGGCCATCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 837 |
| LEAP-Seq percent confirming: | 97.3888 |
| LEAP-Seq n confirming: | 2014 |
| LEAP-Seq n nonconfirming: | 54 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGTTAGCAGCCATAACCCG |
| Suggested primer 2: | ACACGCACACACACACACAC |