| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.055044 |
| Chromosome: | chromosome 8 |
| Location: | 2111162 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g368900 | TSA2 | (1 of 1) PTHR11777//PTHR11777:SF14 - ALANYL-TRNA SYNTHETASE // ALANINE--TRNA LIGASE, CHLOROPLASTIC-RELATED; Alanyl-tRNA-synthetase | CDS/intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGTCGTCGACGCGCGACGCCAGCACCAC |
| Internal bar code: | TACAGAAATCAGTGGCCTTTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 346 |
| LEAP-Seq percent confirming: | 99.6207 |
| LEAP-Seq n confirming: | 6829 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGAGGGAGGGTGTGTGTGT |
| Suggested primer 2: | CATCACTCGACTACGCCAAA |