| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.055107 |
| Chromosome: | chromosome 2 |
| Location: | 4007688 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g097000 | DHP1 | (1 of 1) K01464 - dihydropyrimidinase (DPYS, dht, hydA); Dihydropyrimidinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCGGTCAGCTGTTTCCTCTTCGAAACAA |
| Internal bar code: | CCCCGAATCGGGGGGAGGGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 570 |
| LEAP-Seq percent confirming: | 99.5163 |
| LEAP-Seq n confirming: | 823 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCCTCTATTTAATTGCCCG |
| Suggested primer 2: | ACTGTTTCAACCTTGCACCC |