| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.055113 |
| Chromosome: | chromosome 12 |
| Location: | 5176480 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g527500 | (1 of 1) K04508 - transducin (beta)-like 1 (TBL1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGCTTGCCGACTGTCCCTAACATAGTAA |
| Internal bar code: | CTGCCTGATCAGGAGACTACTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 959 |
| LEAP-Seq percent confirming: | 99.7197 |
| LEAP-Seq n confirming: | 7114 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTCTCGACATCTACGGGC |
| Suggested primer 2: | TGGTGGACATCAGGAAGTGA |