Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.055141 |
Chromosome: | chromosome_10 |
Location: | 4560150 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre10.g452400 | CSF1 | Predicted protein of CSF family | antisense | 3'UTR |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | CGTGGCGGGGGGAGGGGCGTGAGAGTTGTT |
Internal bar code: | GTTGGTGCTTCATCGAGCTAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1006 |
LEAP-Seq percent confirming: | 99.5913 |
LEAP-Seq n confirming: | 12427 |
LEAP-Seq n nonconfirming: | 51 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGGAGCTTTAGGTGCTTTTG |
Suggested primer 2: | TCTACGTCGCAGGACATCTG |