| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.055194 |
| Chromosome: | chromosome 6 |
| Location: | 5464919 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g284500 | RPH1,RNPH1 | 3'-5' Exoribonuclease PH component of the Exosome; (1 of 1) K11600 - exosome complex component RRP41 (RRP41, EXOSC4, SKI6) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGAAAGCGACTTGACTCATCCTCCGCGCA |
| Internal bar code: | AGCTTAACGAGGGTACGGGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 376 |
| LEAP-Seq percent confirming: | 98.153 |
| LEAP-Seq n confirming: | 372 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATTTCCGCAGCAATTTCAC |
| Suggested primer 2: | CGTCGGCACTTCACTTCATA |