| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.055208 |
| Chromosome: | chromosome 10 |
| Location: | 2815462 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g439400 | GAT1 | Glutamyl tRNA amidotransferase, subunit A; (1 of 1) K02433 - aspartyl-tRNA(Asn)/glutamyl-tRNA(Gln) amidotransferase subunit A (gatA, QRSL1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCAGCTACATTACCGTGGACGGCGAGCA |
| Internal bar code: | CTCCCATCATCACATCAGATCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1 |
| LEAP-Seq percent confirming: | 99.883 |
| LEAP-Seq n confirming: | 3415 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACAAGGTCATTCCATTCGC |
| Suggested primer 2: | CCTGTGGACTGAGCAAGTGA |