Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.055227 |
Chromosome: | chromosome 7 |
Location: | 3048680 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g333535 | (1 of 1) K04856 - voltage-dependent calcium channel T type alpha-1I (CACNA1I) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACTGTGGTTTGCAAATGCTTTCAACTCGT |
Internal bar code: | GGTGGTAGACGATTGAACGCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 603 |
LEAP-Seq percent confirming: | 98.3122 |
LEAP-Seq n confirming: | 233 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTGGGCAGTGGAGAAGATA |
Suggested primer 2: | TACCACAAGTGTCCACGGAA |