| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.055294 |
| Chromosome: | chromosome 2 |
| Location: | 5261967 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g106400 | PDAT1,LCA1 | Phospholipid diacylglycerol acyltransferase; (1 of 1) 2.3.1.158 - Phospholipid:diacylglycerol acyltransferase / PDAT | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCGACCATGTGGGTGAACAGCACAGTGCC |
| Internal bar code: | AGATGCTAGATAGAGTAAGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 369 |
| LEAP-Seq percent confirming: | 97.592 |
| LEAP-Seq n confirming: | 1459 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCGCTCCCATATCCAATC |
| Suggested primer 2: | GTCCTTGACTCTGTCGGCTC |