Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.055295 |
Chromosome: | chromosome 10 |
Location: | 3207404 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g442650 | (1 of 1) PTHR10887:SF366 - DNA-BINDING PROTEIN-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCTTGCAGCCCAACGACAATTTGGCGGG |
Internal bar code: | AACGCCCTGTAATTCGGCAGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 497 |
LEAP-Seq percent confirming: | 94.6794 |
LEAP-Seq n confirming: | 2082 |
LEAP-Seq n nonconfirming: | 117 |
LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTTGGCCAGTTTCTCTAGC |
Suggested primer 2: | ATGACCGGTAGTATGGCTGC |