| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.055299 |
| Chromosome: | chromosome 3 |
| Location: | 464683 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g145087 | MTP1 | Metal Transport Protein 1; (1 of 1) K14689 - solute carrier family 30 (zinc transporter), member 2 (SLC30A2, ZNT2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGACGGCGGCCCTGCGGCCGTCTTAGCGA |
| Internal bar code: | CCCTTAATTTCGCCGAGCCTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1066 |
| LEAP-Seq percent confirming: | 98.834 |
| LEAP-Seq n confirming: | 12121 |
| LEAP-Seq n nonconfirming: | 143 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGTGACACGGGCAGGTAGT |
| Suggested primer 2: | CAGTGGTGTACTGGTGTGCC |