| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.055404 |
| Chromosome: | chromosome 1 |
| Location: | 4725738 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g032550 | CGL127 | (1 of 1) K11267 - sister chromatid cohesion protein PDS5 (PDS5); Conserved in the Green Lineage | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCAGTCCACCAGCAGCTCGTACACCAAC |
| Internal bar code: | TGGTCGACTTCACTGGGAATCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 830 |
| LEAP-Seq percent confirming: | 99.1793 |
| LEAP-Seq n confirming: | 3021 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGGCAGCTTAGCATACTTC |
| Suggested primer 2: | AGGGAAAGGACAACATCGTG |