| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.055433 |
| Chromosome: | chromosome 17 |
| Location: | 2371741 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g714950 | (1 of 18) PF12906 - RING-variant domain (RINGv) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGGAGCGCTGACGGTTACCCACACGGAC |
| Internal bar code: | CGTATCATCACCGTATCCCTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 612 |
| LEAP-Seq percent confirming: | 99.902 |
| LEAP-Seq n confirming: | 1019 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACAATGTCCAAAGAAGCA |
| Suggested primer 2: | GCTCACTTCTAGCGCTCGTT |