Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.055441 |
Chromosome: | chromosome 16 |
Location: | 1691131 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g654700 | PHC61 | Pherophorin-chlamydomonas homolog 61; (1 of 71) PF12499 - Pherophorin (DUF3707) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTACCATTACCAGCTATCGCAAGAAGGGTT |
Internal bar code: | AGGACAGATACTGCAAGCGGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 935 |
LEAP-Seq percent confirming: | 98.2695 |
LEAP-Seq n confirming: | 1590 |
LEAP-Seq n nonconfirming: | 28 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACCCGTTTCCTTACAACGC |
Suggested primer 2: | AGAAACTACCCCATTGCACG |