| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.055448 |
| Chromosome: | chromosome 10 |
| Location: | 5361918 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g458183 | (1 of 3) 1.14.19.2 - Stearoyl-[acyl-carrier-protein] 9-desaturase / Stearyl-ACP desaturase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGGCTTGTCACGCTGTCCCCACACGCGT |
| Internal bar code: | ATAAACAGTGCCGGTCAGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 716 |
| LEAP-Seq percent confirming: | 98.0908 |
| LEAP-Seq n confirming: | 1901 |
| LEAP-Seq n nonconfirming: | 37 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCCGTCAAACAGCTATGAG |
| Suggested primer 2: | GCTGTGACGCAGGTATCTCA |