Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.055500 |
Chromosome: | chromosome 2 |
Location: | 5398182 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g107350 | DHC4 | (1 of 3) IPR003593//IPR004273//IPR011704//IPR013602//IPR024317//IPR024743//IPR026983//IPR027417 - AAA+ ATPase domain // Dynein heavy chain domain // ATPase, dynein-related, AAA domain // Dynein heavy chain, domain-2 // Dynein heavy chain, P-loop containing D4 domain // Dynein heavy chain, coiled coil stalk // Dynein heavy chain // P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGCGTGGTGTTCATCGACGACCTGAACA |
Internal bar code: | TCGGGTTGTACTTGCTGTATCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 914 |
LEAP-Seq percent confirming: | 99.8486 |
LEAP-Seq n confirming: | 1319 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAATCATGGCGTTCAACATC |
Suggested primer 2: | CCAAGTGAGAGCCTGTCCTC |